Target: D-alanine D-alanine ligase NCBI Gene # or RefSeq#: NC_003143.1 Protein ID or Wolbachia#: YP_002345628.1 Organism: Yersinia pestis Etiologic Risk Group: Risk Group 3 Disease Information: Yersinia pestis is a bacterium that causes a variation of plague in humans and other mammals. Humans typically get plague after being bitten by a rodent flea that is carrying the plague bacterium, encountering contaminated fluids or tissue, or inhaling infections droplets. Plague is notorious for killing millions of people in Europe during the Middle Ages. Since that time, plague has occurred in rural and semi-rural areas of the western United States. Without immediate treatment, the disease can cause serious illness or death. The most common form of plague is bubonic plague, which infects the lymphatic system and causes inflammation. When the bacteria enter the bloodstream, the disease is then recognized as septicemic plague. Alternatively, if the bacteria spread to the lungs, the disease is then considered to be pneumonic plague, which is the only form of plague that can be transmitted between people. One of the enzymes that helps Yersinia pestis infect its host is D-alanine D-alanine ligase, which synthesizes D-alanyl-D-alanine, an essential precursor of bacterial peptidoglycan. For this reason, D-alanine ligase is an important target for the development of antibacterial drugs. Link to TDR Targets page: N/A Link to Gene Database page:https://www.ncbi.nlm.nih.gov/gene/1173401 Essentiality of this Protein: D-alanine D-alanine ligase is an essential enzyme in bacterial cell wall biosynthesis. Is it a monomer or multimer as biological unit? Multimer Complex of Proteins?D-alanine D-alanine ligase consists of three domains, in which four loops, loop 1, loop 2, loop 3 and loop 4, constitute the binding sites for two D-alanine molecules and one ATP molecule. Druggable Target (list number or cite evidence from a paper/database showing druggable in another organism): https://www.ncbi.nlm.nih.gov/pubmed/23286234 EC#: 6.3.2.4 Link to BRENDA EC# page: https://www.brenda-enzymes.org/enzyme.php?ecno=6.3.2.4&Suchword=&reference=&UniProtAcc=&organism%5B%5D=Yersinia+pestis&show_tm=0 Enzyme Assay information (spectrophotometric, coupled assay ?, reagents): http://vdsstream.wikispaces.com/file/view/KovacDalanineDalanineLigaseVirtualScreenJMedChem2008.pdf/261437724/KovacDalanineDalanineLigaseVirtualScreenJMedChem2008.pdf Link to Sigma page for Assay: http://scripts.iucr.org/cgi-bin/paper?S2059798315021671 http://www.sigmaaldrich.com/catalog/product/sigma/a7377?lang=en®ion=US Substrate Cost: $37.40 Substrate Quantity:5G Substrate Catalog #: A7377-5G PDB Structure: 5C1P Current Inhibitors: http://vdsstream.wikispaces.com/file/view/KovacDalanineDalanineLigaseVirtualScreenJMedChem2008.pdf/261437724/KovacDalanineDalanineLigaseVirtualScreenJMedChem2008.pdf Expression Information (has it been expressed in bacterial cells):D-alanine D-alanine ligase has been expressed in E. coli. Purification Method:Ni-NTA Image of Protein:
Length of your protein in Amino Acids: 307 AA Molecular Weight of your protein in kiloDaltons using the Expasy ProtParam website: 33261.23 Molar Extinction coefficient of your protein at 280 nm wavelength: 31525 TMpred graph Image (http://www.ch.embnet.org/software/TMPRED_form.html): CDS Gene Sequence:
GC% Content for Gene (codon optimized): N/A Primer design results for pNIC-Bsa4 cloning (list seqeunces of all of your ~40 nt long primers): DNA Works File:https://drive.google.com/drive/folders/0B4O2KqKh2q_-dFJuSVJtcDgtUUU Primer Design Results for 'Tail' Primers: YpDAL_for: TACTTCCAATCCATGGCGGAAAAAGTTGCGGTTCT YpDAL_rev: TATCCACCTTTACTGTTAGTCCGCCAGCATCAGGA
NCBI Gene # or RefSeq#: NC_003143.1
Protein ID or Wolbachia#: YP_002345628.1
Organism: Yersinia pestis
Etiologic Risk Group: Risk Group 3
Disease Information: Yersinia pestis is a bacterium that causes a variation of plague in humans and other mammals. Humans typically get plague after being bitten by a rodent flea that is carrying the plague bacterium, encountering contaminated fluids or tissue, or inhaling infections droplets. Plague is notorious for killing millions of people in Europe during the Middle Ages. Since that time, plague has occurred in rural and semi-rural areas of the western United States. Without immediate treatment, the disease can cause serious illness or death. The most common form of plague is bubonic plague, which infects the lymphatic system and causes inflammation. When the bacteria enter the bloodstream, the disease is then recognized as septicemic plague. Alternatively, if the bacteria spread to the lungs, the disease is then considered to be pneumonic plague, which is the only form of plague that can be transmitted between people. One of the enzymes that helps Yersinia pestis infect its host is D-alanine D-alanine ligase, which synthesizes D-alanyl-D-alanine, an essential precursor of bacterial peptidoglycan. For this reason, D-alanine ligase is an important target for the development of antibacterial drugs.
Link to TDR Targets page: N/A
Link to Gene Database page: https://www.ncbi.nlm.nih.gov/gene/1173401
Essentiality of this Protein: D-alanine D-alanine ligase is an essential enzyme in bacterial cell wall biosynthesis.
Is it a monomer or multimer as biological unit? Multimer
Complex of Proteins? D-alanine D-alanine ligase consists of three domains, in which four loops, loop 1, loop 2, loop 3 and loop 4, constitute the binding sites for two D-alanine molecules and one ATP molecule.
Druggable Target (list number or cite evidence from a paper/database showing druggable in another organism): https://www.ncbi.nlm.nih.gov/pubmed/23286234
EC#: 6.3.2.4
Link to BRENDA EC# page: https://www.brenda-enzymes.org/enzyme.php?ecno=6.3.2.4&Suchword=&reference=&UniProtAcc=&organism%5B%5D=Yersinia+pestis&show_tm=0
Enzyme Assay information (spectrophotometric, coupled assay ?, reagents): http://vdsstream.wikispaces.com/file/view/KovacDalanineDalanineLigaseVirtualScreenJMedChem2008.pdf/261437724/KovacDalanineDalanineLigaseVirtualScreenJMedChem2008.pdf
Link to Sigma page for Assay: http://scripts.iucr.org/cgi-bin/paper?S2059798315021671
http://www.sigmaaldrich.com/catalog/product/sigma/a7377?lang=en®ion=US
Substrate Cost: $37.40
Substrate Quantity: 5G
Substrate Catalog #: A7377-5G
PDB Structure: 5C1P
Current Inhibitors:
http://vdsstream.wikispaces.com/file/view/KovacDalanineDalanineLigaseVirtualScreenJMedChem2008.pdf/261437724/KovacDalanineDalanineLigaseVirtualScreenJMedChem2008.pdf
Expression Information (has it been expressed in bacterial cells): D-alanine D-alanine ligase has been expressed in E. coli.
Purification Method: Ni-NTA
Image of Protein:
Amino Acid Sequence:
Length of your protein in Amino Acids: 307 AA
Molecular Weight of your protein in kiloDaltons using the Expasy ProtParam website: 33261.23
Molar Extinction coefficient of your protein at 280 nm wavelength: 31525
TMpred graph Image (http://www.ch.embnet.org/software/TMPRED_form.html):
CDS Gene Sequence:
GC% Content for Gene: N/A
CDS Gene Sequence (codon optimized):
GC% Content for Gene (codon optimized): N/A
Primer design results for pNIC-Bsa4 cloning (list seqeunces of all of your ~40 nt long primers):
DNA Works File: https://drive.google.com/drive/folders/0B4O2KqKh2q_-dFJuSVJtcDgtUUU
Primer Design Results for 'Tail' Primers:
YpDAL_for: TACTTCCAATCCATGGCGGAAAAAGTTGCGGTTCT
YpDAL_rev: TATCCACCTTTACTGTTAGTCCGCCAGCATCAGGA